Part:BBa_K4983000:Design
selective aptamer sequence for deltamethrin identification and binding
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
To develop a DNA aptamer selective for deltamethrin, capable of being utilized in our detection system, we had to merge a sequence selective for our target molecule and a second sequence, the S segment, as mentioned above. The S sequence is complementary to the cdAPT strand, thus the initial DNA duplex molecule can be formed to begin the detection process. Additionally the S segment is complementary to the a*b*c* part of L1 so that the hybridization cascade can commence and the detection process can proceed. Regarding the sequences themselves, they were selected from certain publications. The S segment sequence was obtained from the publication (Chen et al., 2023) , in which an antibiotic detection system, from which we modeled to design our own system, is described. As for the deltamethrin selective sequence there is no such sequence published yet. For the purpose of designing this sequence we conducted further research. The result of this research was a publication (Yang et al., 2021) that described the procedure of the design of an aptamer with high affinity to l-cyhalothrin, which belongs in the same family of pesticides (pyrethroids) as our target molecule, and listed 31 candidate sequences with increasing affinity to l-cyhalothrin. Therefore we had concerns about whether the complete sequence would eventually have adequate affinity and bind to the molecule chosen for our biosensor. For this reason we designed 31 selective sequence-S ssDNAs, from which we would eventually select the most selective one.
EXPERIMENTAL CYCLE 1
Experimental selectivity procedure was initially carried out by conducting a docking process in silico ,thus achieving an initial screening of candidate aptamer sequences. To conduct the docking, we imported into the MOE software the 3D structures (as .pdb files) of the candidate DNA aptamers separately with deltamethrin and l-cyhalothrin in order to evaluate whether the selectivity of the selective sequences are extended to deltamethrin as well and identify the aptamer with the highest affinity to deltamethrin . The scores of this particular part when interacting with the target molecule were the most negative among the other candidates suggesting that the complex they formed was the most stable. That result indicates that it is the most selective and suitable aptamer for our biosensor and furthermore for deltamethrin binding (compared to the available literature), but further confirmation had to be obtained.For that purpose we identified the 2 aptamers with higher affinity to deltamethrin and we proceeded to test them by conducting a second cycle of experiments using the QCM method (detailed description of docking process and results can be found at http://2023.igem.wiki/unicrete/engineering, at "CYCLE 1: DNA aptamers docking for choosing the aptamer with the best scores for deltamethrin" section)
http://static.igem.wiki/teams/4983/wiki/registry9.png
Picture 2. dAPT 2D structure used to predict the 3D structure of dAPT as described at the engineering page. ( obtained using UNAFold Web Server )
http://static.igem.wiki/teams/4983/wiki/registry3.png
Picture 3. dAPT 3D structure used in the docking software to determine its binding affinity to deltamethrin and l-cyhalothrin. (visualized at PyMol)
http://static.igem.wiki/teams/4983/wiki/registry5.png
Picture 4. 3D structure of l-cyhalothrin used in docking.(visualized at PyMol)
http://static.igem.wiki/teams/4983/wiki/registry4.png
Picture 5. 3D structure of deltamethrin used in docking.(visualized at PyMol)
http://static.igem.wiki/teams/4983/wiki/registry7.png
Figure 1. In this table the SCORES (docking affinity index) of the 5 most stable dAPT-11-deltamethrin complexes are listed ( As the value of the score decreases the stability and the affinity while binding increases )
http://static.igem.wiki/teams/4983/wiki/registry6.png
Figure 2. In this table the SCORES (docking affinity index) of the 5 most stable dAPT-11-l-cyhalothrin complexes are listed ( As the value of the score decreases the stability and the affinity while binding increases )
EXPERIMENTAL CYCLE 2
To assess the selectivity of delta in relation to the two aptamers, dAPT-11 and dAPT-15, we employed an acoustic Quartz Crystal Microbalance (QCM) biosensor. Our experimental approach encompassed a sequence of six distinct experiments, with each successive iteration informed by the preceding one, given the absence of established experimental protocols specific to deltamethrin. In the experiments, different amounts of delta and different concentrations of aptamers were used, as well as a control sensor in which only delta was introduced (without any of the aptamers) in order to detect the non-specific bindings between delta and the sensor, which is made of gold and on its surface we have administered neutravidin which serves to form bonds with the 3' biotinylated end of the aptamers. Although the sensors with the aptamers gave the same signals there was a small difference. It became evident that dAPT-11 exhibited marginally larger signals and it gave signals in the initial experiments that were more interpretable. For instance, in an experiment where the aptamer was tested at concentrations of 2.5 pmol and 5 pmol, the signal disparity was notably more pronounced than in the case of dAPT-15, where the signals at 2.5 pmol and 5 pmol were closely matched, contrary to expectations. Hence, the evidence and insights gleaned from these experiments led us to the conclusion that, based on the aforementioned observations, dAPT-11 emerged as the preferred aptamer for integration into our system.(more details abaout QCM conduction and results can be found at http://2023.igem.wiki/unicrete/engineering, at "CYCLE 2: Determining the aptamer with the highest affinity for deltamethrin through acoustic Quartz Crystal Microbalance (QCM) biosensor experiments" section)
http://static.igem.wiki/teams/4983/wiki/registry8-png.jpg
Figure 3. Analysis of QCM results
The aptamer sequence listed here is the product of the above succesfull experimental procedures. Docking and QCM details and results are all listed and analyzed at our engineering page (http://2023.igem.wiki/unicrete/engineering)
Conclusion
Considering the above results we conclude that this basic part is a fairly selective aptamer for deltamethrin binding, especially if one takes into account the fact that there are no known aptamers for this particular pesticide. By optimizing the experimental conditions as well as further evaluation of its sensitivity, this part has the potential to be used in future systems, including sensors, pesticide diagnostics,bioimaging and bioremediation projects. This part's ease of use may make it a valuable tool for detection (either alone or in multi detection processes) in future iGEM endeavours. It can also improve the ever-expanding registry section that focuses on aptamer detection, a technique that is gaining traction in the field of synthetic biology.
Source
The aptamers S segment (CAAAATCTACCTACTCACACTATA) was acquired from Supportive Information Table S1' of: Chen et al., 2023
The selective sequence (GGACAGCGCGGGAGGTTAGCACGCGGAAT ) was obtained from Supportive Information Table S1 of : Yang et al., 2021
References
1. Chen, J., Shi G., Yan, C. (2023) Portable biosensor for on-site detection of kanamycin in water samples based on CRISPR-Cas 12 A and an off-the-shelf glucometer. Science of The Total Environment, 872, 162279.https://doi.org/10.1016/j.scitotenv.2023.162279.
2.Yang, Y., Tang, Y., Wang, C., Liu, B., & Wu, Y. (2021). Selection and identification of a DNA aptamer for ultrasensitive and selective detection of λ-cyhalothrin residue in food. Analytica Chimica Acta, 1179, 338837.https://doi.org/10.1016/j.aca.2021.338837.